Structural RNAs:
tRNAs: tRNAscan-SE- (Univerisity of California at San Diego, U.S.A,) is incredibly sensitive & also provides secondary structure diagrams of the tRNA molecules. It can also be accessed here or here . Alternatively use ARAGORN (Reference: Laslett, D. & Canback. 2004. Nucleic Acids Research 32:11-16) or FindtRNA - (D. Paul & Md. Aftabuddin, West Bengal University of Technology, India) - identifies tRNA genes without introns or with introns at canonical or non-canonical positions.
ARWEN - is a program to detect tRNAs in metazoan mitochondrial DNA sequences (Reference: D. Laslett & B. Canbäck B. 2008. Bioinformatics 24:172-175)
Rfam - The Rfam database is a collection of RNA families, each represented by multiple sequence alignments, consensus secondary structures and covariance models (Reference: Gardner, P.P. et al. 2008. Nucl. Acids Res. 37, Database issue D136-D140)
Ribosomal RNA BLAST - BLASTN searches against the small (SSU) &/or large (LSU) subunit RNA databases Unfortunately the input is limited to a maximum of 10000 nucleotides. This site has been superceded by GeoBLAST at Silva which provides a comprehensive, quality checked and regularly updated databases of aligned small (16S/18S, SSU) and large subunit (23S/28S, LSU) ribosomal RNA (rRNA) sequences for all three domains of life.
Test sequences .
Predicted tRNA Secondary Structures:Your-seq.trna1 (1-74) Length: 74 bp Type: Ile Anticodon: AAT at 35-37 (35-37) Score: 65.31 * | * | * | * | * | * | * | Seq: GGTCTCTTGGCCCAGTTGGTtAAGGCACCGTGCTAATAACGCGGGGAtCAGCGGTTCGATCCCGCTAGAGACCA Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
TFAM - unlike tRNA gene-finders, TFAM uses information from the total sequences of tRNAs and not just their anticodons to predict their function. Therefore TFAM has an advantage in predicting initiator tRNAs, the amino acid charging identity of nonstandard tRNAs such as suppressors, and the former identity of pseudo-tRNAs (Reference: Tåquist,H. et al. 2007. Nucleic Acids Res. 2007 35(Web Server issue): W350–W353). It can also be accessed here.
tmRNAs: BRUCE - detects transfer-messenger RNAs which function to free ribosome-stalled mRNAs. (Reference: Laslett, D., et al. 2002. Nucleic Acids Res. 30: 3449-3453, 2002) .
Small nucleolar RNAs (snoRNAs) - can be detected with Snoscan for methylation-guide for snoRNAs and snoGPS for pseudouridylation-guide snoRNAs (Reference: P. Schattner et al. 2005. Nucl. Acids Res. 33: W686-W689). Test sequences.
Mireval: a web tool for simple microRNA prediction (Reference: Ritchie, W. et al. 2008. Bioinformatics 24:1394-1396).
RNAmmer 1.2 - predicts 5s/8s, 16s/18s, and 23s/28s ribosomal RNA in full genome sequences (Reference: Lagesen, K et al. 2007. Nucl. Acids Res. 35: 3100-3108)
Ribosomal RNA BLAST (University of gent, Belgium) - BLASTN against the SSU (16S) and LSU (23S) rRNA databases; and a quick phylogeny search.
RNA folding:
MARNA - Multiple Alignment of RNAs - is a multiple alignment of RNA s taking into consideration both the primary sequence and the secondary structure. (Reference: S. Siebert & R. Backofen. 2005. Bioinformatics 21: 3352 - 3359). Results with four tRNA-Ala sequences from spirochetes are shown below:
S_aurantia GGGGGUAUAGCU---CAGU--U--------G--GUAGAGCGUCAGCUUUGCAAGCUGAAUGUCUGGGGUUCGAAUCCCCAUGCCUCCA
T_denticola GGGGAUAUAGCUCAGCUGGCUAGAGC----G--GCGGCUUUGCA-AGCCGUA------G-GUCAGGGGUUCGAAUCCCCUUAUCUCCA
T_medium GGGGAUAUAGCUCAGCUGGCUAGAGC----G--GCGGCUUUGCA-AGCCGUA------G-GUCAGGGGUUCGAAUCCCCUUAUCUCCA
T_pallidum GGGGGUAUAGCU---CAAC--U-GGCUAGAGCGACGGCUUUGCA-GGUCGUA------G-GUCAGGGGUUCGAGUCCCCUUAUCUCCA
ConSeq
GGGGaUAUAGCUcagCaggcuagagc____G__gcgGcuuugCA_agccGuA______g_GUCaGGGGUUCGAaUCCCCuUauCUCCA
S_aurantia
(((((((....(---((((--(--------.--(((((((....))))))).))))))......((((.......)))).))))))).
T_denticola
(((((((..((((((....)).))))----.--((((((.....-)))))).------.-...(((((.......)))))))))))).
T_medium
(((((((..((((((....)).))))----.--((((((.....-)))))).------.-...(((((.......)))))))))))).
T_pallidum
((((((((((((---....--.-)))))((.(.((((((.....-)))))).------)-.)).((((.......)))).))))))).
ConStr
(90%)(((((((...................____.__((((((....._)))))).______._....((((.......)))).))))))).
FOLDALIGN - folds and aligns RNA structures (make a foldalignment) based on a lightweight energy model and sequence similarity. The current version makes pairwise fold alignments. (Reference: J. H. Havgaard et al. 2005. Bioinformatics 21: 1815 - 1824)
For RNA folding use MFold (Michael Zuker, Rensselaer Polytechnic Institute, U.S.A.). N.B. The data can be presented in a number of graphic formats.
Vienna RNA secondary structure prediction (University of Vienna, Austria). I have found this site useful for drawing tRNAs in cloverleaf format.
CONTRAfold is a novel secondary structure prediction method based on conditional log-linear models, a flexible class of probabilistic models which generalize upon stochastic context-free grammars by using discriminative training and feature-rich scoring. By incorporating most of the features found in typical thermodynamic models, CONTRAfold achieves the highest single sequence prediction accuracies to date, outperforming currently available probabilistic and physics-based techniques. It provides MARNA-like output couples with hairpin structures (Reference: Do, C.B. et al. 2006. Bioinformatics 22: e90-e98).
Radar (RNA Data Analysis and Research) - provides (1) constrained alignment of RNA secondary structures, and (2) prediction of the consensus structure for a set of RNA sequences. RADAR performs many important RNA mining operations, including understanding the functionality of RNA sequences, the detection of structural RNA motifs and the clustering of RNA molecules. (Reference: Khaladkar, M. et al. 2007. Nucl. Acids Res. 35: W300-W304)
Pseudoknots:
Kinefold RNA/DNA folding predictions including pseudoknots and entangled helices. Provides (i) a series of low free energy structures, (ii) an online animated folding path and (iii) a programmable trajectory plot focusing on a few helices of interest to each user. (Reference: A. Xayaphoummine et al. 2005. Nucl. Acids Res. 33: W605-W6). Structure of GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA is shown below:
pknotsRG (Universität Bielefeld, Germany) - is a series of 3 tools for folding RNA secondary structures, including the class of simple recursive pseudoknots. Unfortunately to optimally view the results one needs Microsoft.NET framework (massive) and PseudoViewer2 (School of Computer Science and Engineering, Inha University, Korea).
HPknotter: A Heuristic Approach for Detecting RNA H-type Pseudoknots - offers a variety of tools including pknotsRG, PNOTS and NUPACK (Reference: C
.-H. Huang et al. 2005. Bioinformatics 21: 3501-3508).
RNATOPS-W - a profile based RNA structure search program that can detect RNA pseudoknots in genomes. For input it requires a structure profile in the pasta format, and genome sequences in the fasta format.
Ribosomal RNA analysis:
Ribosomal RNA Analysis - The Ribosomal Database Project II (Michigan State University Centre for Microbial Ecology, U.S.A.). A tutorial is provided here.
Ridom - Ribosomal RNA analysis for clinically relevant bacteria - (University of Würzburg, Germany)
Rifle - (Universitat Bielefeld, Germany) The RIFLE system compares restriction patterns of 16S rDNA amplicons against a database of theoretical restriction patterns generated from a 16S rDNA database
Promoters, terminators and other regulatory elements:
PromScan (D.J. Studholme & R. Dixon. 2003. Domain architectures of sigma54-dependent transcriptional activators. J. Bacteriol. 185:1757-67; as modified by S. Richards, Queen's University, Canada). Scans small genomes for potential factor-binding sites including IHF-binding sites. If a *.ptt file is included the results will indicate the position of the promoter relative to the nearest gene.
Virtual Footprint - offers two types of analyses (a) Regulon Analysis - analysis of a whole prokaryotic genome with one regulator pattern and (b) Promoter analysis - Analysis of a promoter region with several regulator patterns (Reference: R.
Münch et al. 2005. Bioinformatics 2005 21: 4187-4189).
FindTerm (Softberry Inc.) - is one of only two tools on the internet for mapping rho-independent terminators. You might consider using the advanced feature options and minimally increase the default energy threshold to -12.0.
TransTermHP (A. Villegas, Public Health Agency of Canada) - an online version of TranstermHP, Reference: Kingsford, C. et al. 2007. Genome Biol. 8: R22) an updated version of TransTerm (Reference: Ermolaeva, M.D. et al. 2000. J Mol Biol 301: 27-33)
RibEx: Riboswitch Explorer - scans <40kb DNA for potential genes (which are linked to BLASTP) and several hundred regulatory elements, including riboswitches. If you click on the "search for attenuators" it finds terminators and antiterminators. (Reference: C. Abreu-Goodger & E. Merino. 2005. Nucl. Acids Res. 33: W690-W692).
siRNA:
siRNA Target Designer (Promega, U.S.A.) - Small interfering RNA (siRNA) guides sequence-specific degradation of the homologous mRNA, thus producing "knock-down" cells. Another similar program is siRNA Target Finder (Ambion, U.S.A.).
siRNA Design Software - compares existing design tools, including those listed above. They also attempt to improve the MPI principles and existing tools by an algorithm that can filter ineffective siRNAs. The algorithm is based on some new observations on the secondary structure. (Reference: S. M. Yiu et al. (2004) Bioinformatics 21: 144-151).
ARTS - Alignment of RNA Tertiary Structures - aligns two nucleic acid structures (RNAs or DNAs) in pdb format and detecting apriori unknown common substructures. The identified common substructures can be either large global folds or small local tertiary motifs with at least two successive base pairs. (Reference: O.
Dror et al. 2005. Bioinformatics 21(suppl_2: ):ii47-ii53)