Structural RNAs:

A. Ribosomal RNA analysis

red_bullet.gif (914 bytes) SILVA rRNA database project (Max Planck Institute for Marine Microbiology, Bremen, Germany ) - provides comprehensive, quality checked and regularly updated datasets of aligned small (16S/18S, SSU) and large subunit (23S/28S, LSU) ribosomal RNA (rRNA) sequences for all three domains of life (Bacteria, Archaea and Eukarya).

red_bullet.gif (914 bytes) RNAmmer 1.2 - predicts 5s/8s, 16s/18s, and 23s/28s ribosomal RNA in full genome sequences (Reference: Lagesen, K et al. 2007. Nucl. Acids Res. 35: 3100-3108)

red_bullet.gif (914 bytes) The Ribosomal Database Project (RDP(Michigan State University Centre for Microbial Ecology, U.S.A.) - provides ribosome related data and services, including online data analysis and aligned and annotated Bacterial and Archaeal small-subunit 16S rRNA sequences.A tutorial is provided here.

red_bullet.gif (914 bytes) Ridom - Ribosomal RNA analysis for clinically relevant bacteria - (University of Würzburg, Germany)
red_bullet.gif (914 bytes) Rifle - (Universitat Bielefeld, Germany) The RIFLE system compares restriction patterns of 16S rDNA amplicons against a database of theoretical restriction patterns generated from a 16S rDNA database

red_bullet.gif (914 bytes) rRNA prediction (hmm_rRNA) - predicts rRNA by using HMMER 3.0 to identify DNA reads containing rRNA sequences. (Reference: S. Wu et al. 2011. BMC Genomics 12:444).

B. Transfer RNAs (tRNA) - for additional information see the genomic tRNA database GtRNAdb or Transfer RNA database tRNAdb

red_bullet.gif (914 bytes) tRNAs: tRNAscan-SE- (Univerisity of California, Santa Cruz, U.S.A,) is incredibly sensitive & also provides secondary structure  diagrams of the tRNA molecules (Reference: Lowe, TM, & Eddy, SR. Nucleic Acids Res. 1997. 25: 955-964) tRNAscan-SE 2.0 can also be accessed here.  Alternatively use ARAGORN   (Reference: Laslett, D. & Canback. 2004. Nucleic Acids Research 32:11-16) or FindtRNA - (D. Paul & Md. Aftabuddin, West Bengal University of Technology, India) - identifies tRNA genes without introns or with introns at canonical or non-canonical positions.

red_bullet.gif (914 bytes) ARWEN - is a program to detect tRNAs in metazoan mitochondrial DNA sequences (Reference: D. Laslett & B. Canbäck B. 2008. Bioinformatics 24:172-175)

red_bullet.gif (914 bytes) Rfam - The Rfam database is a collection of RNA families, each represented by multiple sequence alignments, consensus secondary structures and covariance models (Reference: Gardner, P.P. et al. 2008. Nucl. Acids Res. 37, Database issue D136-D140)

red_bullet.gif (914 bytes) TFAM - unlike other tRNA gene-finders, TFAM uses information from the total sequences of tRNAs and not just their anticodons to predict their function. Therefore TFAM has an advantage in predicting initiator tRNAs, the amino acid charging identity of nonstandard tRNAs such as suppressors, and the former identity of pseudo-tRNAs. New TFAM models are available including a proteobacterial model for the bacterial lysylated isoleucine tRNAs, making it now possible for TFAM to correctly classify all tRNA genes for some bacterial taxa.(Reference: H.Tåquist et al. 2007. Nucleic Acids Res. 35 (suppl 2): W350-W353).

red_bullet.gif (914 bytes) tmRNAs:  ARAGORN, tRNA (and tmRNA) detection   - detects transfer-messenger RNAs which function to free ribosome-stalled mRNAs. (Reference: Laslett, D., et al. 2002.  Nucleic Acids Res. 30: 3449-3453, 2002) .

C. Micro RNAs  (miRNAs) are small, non-coding RNA (~20-22 nucleotides) that negatively regulate gene expression at post-transcriptional level.

red_bullet.gif (914 bytes) mirTools - users can: (i) filter low-quality reads and 3/5' adapters from raw sequenced data; (ii) align large-scale short reads to the reference genome and explore their length distribution; (iii) classify small RNA candidates into known categories, such as known miRNAs, non-coding RNA, genomic repeats and coding sequences; (iv) provide detailed annotation information for known miRNAs, such as miRNA/miRNA*, absolute/relative reads count and the most abundant tag; (v) predict novel miRNAs that have not been characterized before; and (vi) identify differentially expressed miRNAs between samples based on two different counting strategies.(Reference: Zhu, E.L. et al. 2010. Nucl. Acids Res. 38 (suppl 2): W392-W397).

red_bullet.gif (914 bytes) MiRPara - is a SVM-based software tool for prediction of most probable microRNA coding regions in genome scale sequences (Reference: Wu Y.et al. 2011. BMC Bioinformatics. 12(1):107).

red_bullet.gif (914 bytes) miR-BAG predict miRNAs from the genomic sequences as well as from Next Generation Sequencing data. It applies a bootstrap aggregating approach to create an ensemble of three different approaches (naïve Bayes, Best First Decision tree and SVM) to achieve a high accuracy. At present miR-BAG includes 6 different species, 4 for animals (Homo sapiens, Canis familiaris, Mus musculus, Rattus norvegicus) alongwith one nematode (Caenorhabditis elegans) and one insect species (Drosophila melanogaster). miR-BAG was found to perform consistently with accuracy level higher than 90% for several species.(Reference: Jha, A. et al. 2012. PLoS ONE 7(9): e45782.)

red_bullet.gif (914 bytes) Small nucleolar RNAs (snoRNAs) - can be detected with Snoscan for methylation-guide for snoRNAs and snoGPS for pseudouridylation-guide snoRNAs (Reference: P. Schattner et al. 2005. Nucl. Acids Res. 33: W686-W689). Test sequences.

red_bullet.gif (914 bytes) sRNAtoolbox: an integrated collection of small RNA research tools. Includes: sRNAbench: Expression profiling of small RNAs and prediction of novel microRNAs  from deep sequencing data; sRNAde: Differential expression analysis; sRNAblast: Blast analysis of deep sequencing reads against a local nt/nr (NCBI link) database.(Reference: A. Rueda et al. 2015.  Nucl. Acids Res. 43 (W1): W467-W473).

RNA folding:

red_bullet.gif (914 bytes) LocARNA - Multiple Alignment of RNAs - is a tool for multiple alignment of RNA molecules. LocARNA requires only RNA sequences as input and will simultaneously fold and align the input sequences. LocARNA outputs a multiple alignment together with a consensus structure. For the folding it makes use of a very realistic energy model for RNAs as it is by RNAfold of the Vienna RNA package (or Zuker's mfold). For the alignment it features RIBOSUM-like similarity scoring and realistic gap cost. (Reference: C. Smith et al. 2010. Nucl. Acids Res. 38: W373-377).

red_bullet.gif (914 bytes) CARNA is a tool for multiple alignment of RNA molecules. CARNA requires only the RNA sequences as input and will compute base pair probability matrices and align the sequences based on their full ensembles of structures. Alternatively, you can also provide base pair probability matrices (dot plots in .ps format) or fixed structures (as annotation in the FASTA alignment) for your sequences. If you provide fixed structures, only those structures and not the entire ensemble of possible structures is aligned. In contrast to LocARNA, CARNA does not pick the most likely consensus structure, but computes the alignment that fits best to all likely structures simultaneously. Hence, CARNA is particularly useful when aligning RNAs like riboswitches, which have more than one stable structure. (Reference: A. Dragos et al. 2012. Nucleic Acids Reseach 40: W49-W53). 
red_bullet.gif (914 bytes) FOLDALIGN - folds and aligns RNA structures (make a foldalignment) based on a lightweight energy model and sequence similarity. The current version makes pairwise fold alignments. (Reference: J. H. Havgaard et al. J. PLOS computational biology. 3:e193, 2007).
red_bullet.gif (914 bytes) For RNA folding use MFold  -  N.B. The data can be presented in a number of graphic formats.  This is my "go to" site if I'm interested in a secondardy structure for a fragment of RNA or DNA (Reference: M. Zuker. 2003. Nucleic Acids Res. 31: 3406-3415).
red_bullet.gif (914 bytes) Vienna RNA secondary structure prediction  (University of Vienna, Austria). I have found this site useful for drawing tRNAs in cloverleaf format.

red_bullet.gif (914 bytes) CONTRAfold is a novel secondary structure prediction method based on conditional log-linear models, a flexible class of probabilistic models which generalize upon stochastic context-free grammars by using discriminative training and feature-rich scoring. By incorporating most of the features found in typical thermodynamic models, CONTRAfold achieves the highest single sequence prediction accuracies to date, outperforming currently available probabilistic and physics-based techniques. It provides MARNA-like output couples with hairpin structures (Reference: Do, C.B. et al. 2006. Bioinformatics 22: e90-e98).

red_bullet.gif (914 bytes) RNAiFold 2.0: a web server and software to design custom and Rfam-based RNA molecules - providing a user-friendly pipeline to design synthetic constructs having the functionality of given Rfam families. In addition, the new software supports amino acid constraints, even for proteins translated in different reading frames from overlapping coding sequences; moreover, structure compatibility/incompatibility constraints have been expanded. With these features, RNAiFold 2.0 allows the user to design single RNA molecules as well as hybridization complexes of two RNA molecules. (Reference: J.A. Garcia-Martin et al. 2015.  Nucl. Acids Res. 43 (W1): W513-W521).

red_bullet.gif (914 bytes) Web-Beagle: a web server for the pairwise global or local alignment of RNA secondary structures. (Reference: E. Mattei et al. 2015.  Nucl. Acids Res.  43 (W1): W493-W497).

red_bullet.gif (914 bytes) Rclick -  this web server that is capable of superimposing RNA 3D structures by using clique matching and 3D least-squares fitting. Rclick has been benchmarked and compared with other popular servers and methods for RNA structural alignments. In most cases, Rclick alignments were better in terms of structure overlap. It also recognizes conformational changes between structures. (References: Nguyen MN, & Verma C. 2015. Bioinformatics 31:966-968).


red_bullet.gif (914 bytes) Kinefold RNA/DNA folding predictions including pseudoknots and entangled helices. Provides (i) a series of low free energy structures, (ii) an online animated folding path and (iii) a programmable trajectory plot focusing on a few helices of interest to each user. (Reference: A. Xayaphoummine et al. 2005. Nucl. Acids Res. 33: W605-W6). Structure of GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA is shown below:

red_bullet.gif (914 bytes) pknotsRG (Universität Bielefeld, Germany) - is a series of 3 tools for folding RNA secondary structures, including the class of simple recursive pseudoknots. Unfortunately to optimally view the results one needs Microsoft.NET framework (massive) and PseudoViewer(School of Computer Science and Engineering, Inha University, Korea).

red_bullet.gif (914 bytes) HPknotter: A Heuristic Approach for Detecting RNA H-type Pseudoknots - offers a variety of tools including pknotsRG, PNOTS and NUPACK (Reference: C.-H. Huang et al. 2005. Bioinformatics 21: 3501-3508).

red_bullet.gif (914 bytes) HotKnots - Predict RNA secondary structures with pseudoknots prediction (Reference: Ren, J. et al. 2005.  RNA 11: 1494-1504).

red_bullet.gif (914 bytes) vsfold5: RNA Pseudoknot Prediction Server (Chiba Institute of Technology, Japan). Offers lots of control on parameters.

red_bullet.gif (914 bytes) RNAstructure - Predict a Secondary Structure Web Server - combines many separate prediction and analysis algorithms: calculating a partition function, predicting a maximum free energy (MFE) structure, finding structures with maximum expected accuracy, and pseudoknot prediction. This server takes a sequence, either RNA or DNA, and creates a highly probable, probability annotated group of secondary structures, starting with the lowest free energy structure and including others with varied probabilities of correctness.

red_bullet.gif (914 bytes) DotKnot - pseudoknot prediction including kissing hairpins - Intramolecular kissing hairpins are a more complex and biologically important type of pseudoknot in which two hairpin loops form base pairs. They are hard to predict using free energy minimization due to high computational requirements. (Reference: Sperschneider J et al.  2011.  RNA. 17:27-38).

red_bullet.gif (914 bytes) IPknot - IP-based prediction of RNA pseudoKNOTs. Provides services for predicting RNA secondary structures including a wide class of pseudoknots. IPknot can also predict the consensus secondary structure when a multiple alignment of RNA sequences is given. IPknot runs fast and predicts the maximum expected accuracy (MEA) structure using integer programming (IP) with threshold cut. (Reference: Satto, K.  et al. 2011. Bioinformatics 27: i85-i93.)

Promoters, terminators and other regulatory elements:

Virtual Footprint - offers two types of analyses (a) Regulon Analysis - analysis of a whole prokaryotic genome with one regulator pattern and (b) Promoter analysis -  Analysis of a promoter region with several regulator patterns (Reference: R. Münch et al. 2005. Bioinformatics 2005 21: 4187-4189).

 WebGeSTer - Genome Scanner for Terminators - my favourite terminator search program is finally web enabled.  Please note that if you want to analyze data from a *.gbk file you need to use  their conversion program "GenBank2GeSTer" first. A complete description of each terminator including a diagram is produced by this program.  This site linked to an extensive database of transcriptional terminators in bacterial genome (WebGeSTer DB) (Reference: Mitra A. et al. 2011.  Nucl. Acids Res. 39(Database issue):D129-35).

 ARNold -  finds rho-independent terminators in nucleic acid sequences using two complementary programs, Erpin and RNAmotif. The program colors the terminator stem and loop (References: Gautheret D, Lambert A. 2001.  J Mol Biol. 313:1003–11 & Macke T. et al. 2001. Nucleic Acids Res. 29:4724–4735 ).

FindTerm (Softberry Inc.) - is one of only two tools on the internet for mapping rho-independent terminators. You might consider using the advanced feature options and minimally increase the default energy threshold to -12.0.
 TransTermHP (A. Villegas, Public Health Ontario, Canada) - an online version of TranstermHP, Reference: Kingsford, C. et al. 2007. Genome Biol. 8: R22) an updated version of TransTerm (Reference: Ermolaeva, M.D. et al. 2000. J Mol Biol301: 27-33)
RibEx: Riboswitch Explorer - scans <40kb DNA for potential genes (which are linked to BLASTP) and several hundred regulatory elements, including riboswitches. If you click on the "search for attenuators" it finds terminators and antiterminators. (Reference: C. Abreu-Goodger & E. Merino. 2005. Nucl. Acids Res. 33: W690-W692).

red_bullet.gif (914 bytes) RegRNA 2.0 is an integrated web server for identifying functional RNA motifs in an input RNA sequence.  These include Splicing sites (donor site; acceptor site); Splicing regulatory motifs(ESE; ESS; ISE; ISS elements); Polyadenylation sites; Transcriptional motifs (rho-independent terminator; TRANSFAC); Translational motifs (ribosome binding sites); UTR motifs (UTRsite patterns); mRNA degradation elements (AU-rich elements); RNA editing sites (C-to-U editing sites); Riboswitches (RiboSW); RNA cis-regulatory elements (Rfam; ERPIN); Similar functional RNA sequences (fRNAdb); RNA-RNA interaction regions (miRNA; ncRNA). (Reference: Chang TH et al. 2013. BMC bioinformatics 14 Suppl 2:S4).

red_bullet.gif (914 bytes) RegRNA - A Regulatory RNA Motifs and Elements Finder - RegRNA is an integrated web server for identifying the homologs of regulatory RNA motifs and elements against an input mRNA sequence. Both sequence homologs and structural homologs of regulatory RNA motifs can be recognized. The regulatory RNA motifs supported in RegRNA are categorized into several classes: (i) motifs in mRNA 5'-untranslated region (5'-UTR) and 3'-UTR; (ii) motifs involved in mRNA splicing; (iii) motifs involved in transcriptional regulation; (iv) riboswitches; (v) splicing donor/acceptor sites; (vi) inverted repeats; and (vii) miRNA target sites.(Reference: Huang HY et al. 2006. Nucleic Acids Res. 34(Web Server issue):W429-34).


red_bullet.gif (914 bytes)  siRNA Design Software - compares existing design tools, including those listed above. They also attempt to improve the MPI principles and existing tools by an algorithm that can filter ineffective siRNAs. The algorithm is based on some new observations on the secondary structure. (Reference: S. M. Yiu et al. (2004) Bioinformatics 21: 144-151).

red_bullet.gif (914 bytes) ARTS (Alignment of RNA Tertiary Structures) - aligns two nucleic acid structures (RNAs or DNAs) in pdb format and detecting apriori unknown common substructures. The identified common substructures can be either large global folds or small local tertiary motifs with at least two successive base pairs. (Reference: O. Dror et al. 2005. Bioinformatics 21 (Suppl 2):ii47-ii53)

red_bullet.gif (914 bytes) CopraRNA is a tool for sRNA target prediction. It computes whole genome predictions by combination of distinct whole genome IntaRNA predictions (Reference: P.R. Wright et al. 2014. Nucl. Acids Res. 42 (W1), W119-W123).

red_bullet.gif (914 bytes) OligoWalk - calculates thermodynamic features of sense-antisense hybidization. It predicts the free energy changes  of oligonucleotides binding to a target RNA. It can be used to design efficient siRNA targeting a given mRNA sequence. (Reference: Lu, Z.J. & Mathews, D.H. 2008. Nucleic Acids Res.36:640-647).