REPEATS, SECONDARY STRUCTURE & MELTING TEMPERATURE

REPEATS, SECONDARY STRUCTURE

DNA often contains reiterated sequences of differing length. These include direct (e.g. GAAT-N6-GAAT) and inverted (GAAT-N6-ATTC) repeats. The later, if sufficiently close may form stable stem-loop structures.  For secondary structures of RNA or DNA I recommend most highly Michael Zuker’s sites:

red_bullet.gif (914 bytes) For RNA folding use MFold  (Michael Zuker, Rensselaer Polytechnic Institute, U.S.A.).  N.B. The data can be presented in a number of graphic formats. For DNA sequences use this  site
red_bullet.gif (914 bytes) Vienna RNA secondary structure prediction  (University of Vienna, Austria). I have found this site useful for drawing tRNAs in cloverleaf format.

red_bullet.gif (914 bytes) Vfold: A web server for RNA structure and folding thermodynamics prediction (Reference: X. Xu et al. 2014. PLoS One 9(9): e107504).
 

red_bullet.gif (914 bytes) pKiss - is the successor of pknotsRG, the first pseudoknot class is the canonical simple recursive pseudoknot from pknotsRG. The new class are canonical simple recursive kissing hairpins. (Reference: Janssen, S. & Giegerich, R. Bioinformatics, 2015; 31(3):423-5).

red_bullet.gif (914 bytes) vsfold5 - RNA Pseudoknot Prediction Server

GCGGCCAGCUCCAGGCCGCCAAACAAUAUGGAGCAC
((((((..[[[[[)))))).........]]]]]...

 

red_bullet.gif (914 bytes) Viral IRES Prediction System (VIPS) (Reference: Hong, JJ et al. PLoS One. 2013; 8(11): e79288).

red_bullet.gif (914 bytes) KineFold Web Server - RNA/DNA folding predictions including pseudoknots and entangled helices (Reference: A. Xayaphoummine et al. Nucleic Acid Res. 33: 605-610 (2005).

red_bullet.gif (914 bytes) IPknot: IP-based prediction of RNA pseudoKNOTs - rovides services for predicting RNA secondary structures including a wide class of pseudoknots. IPknot can also predict the consensus secondary structure when a multiple alignment of RNA sequences is given. (Reference: K. Sato et al. Bioinformatics, 27: i85-i93, 2011.

red_bullet.gif (914 bytes) REPuter - fast computation of maximal repeats in complete genomes (S. Kurtz & C. Scheiermacher @ Universitat Bielefeld, Germany) - interesting graphical representation of repeats.
red_bullet.gif (914 bytes) REPFIND (ZLAB,  Dr. Zhiping Weng, Boston University, U.S.A.) - on sequences of less than 20kb it provides graphical and statistical analysis on direct repeats.
red_bullet.gif (914 bytes) einverted,  palindrome and equicktandem - (EMBOSS) - find inverted and tandem repeats

red_bullet.gif (914 bytes) Dfam 2.0 - is a database of Repetitive DNA element sequence alignments and consensus sequence models. This open database provides family consensus models in a format that is compatible with an wide-variety of bioinformatics tools while facilitating the transition to Dfam style profile HMMs. (Reference: R. Hubley et al. Nucleic Acids Research (2016) Database Issue 44: D81-89) 

red_bullet.gif (914 bytes) CRISPRfinder  Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) present a curious repeat structure found in many prokaryotic genomes. They show characteristics of both tandem and interspaced repeats. (Reference: I. Grissa et al. 2007. Nucl. Acids Res. 35(Web Server issue): W52-W57).

For those with a fuller knowledge of DNA secondary structure you might want to visit Pázmány Péter Catholic University, The Faculty of Bionics and Information Technologies (Hungary) for:

red_bullet.gif (914 bytes) bend.it and plot.it

red_bullet.gif (914 bytes) model-it - (K. Vlahovicek & S. Pongor) produces incredible pictures of DNA using a variety of parameters. Right click on screen to download the picture, which may not be visible. N.B. you will require Rasmol to visualize the results (*.pdb file).
red_bullet.gif (914 bytes) DNA curvature analysis - (Gohlke,  C. University of California, Irvine, U.S.A.) offers a variety of methods for analyzing DNA curvature.
red_bullet.gif (914 bytes) MUTACURVE - predicts the extent of DNA curvature. Enter your sequence in the following area, in FASTA format or as plain sequence (at least 60 and up to 1400 bases). (Reference: De la Cruz MA et al. 2009. Microbiology. 155: 2127-2136).

red_bullet.gif (914 bytes) GBshape (A Genome Browser database for DNA shape annotations) - DNA shape analysis has been established in recent years as an approach that reveals protein- DNA binding specificity determinants beyond nucleotide sequence. GBshape provides DNA shape annotations of entire genomes: annotations for minor groove width (MGW), propeller twist (ProT), Roll, helix twist (HelT), and hydroxyl radical cleavage (ORChID2). GBshape contains two major tools, a Genome Browser and a Table Browser. The Genome Browser provides a graphical representation of DNA shape annotations along standard genome browser annotations. The Table Browser enables the data manipulation, downloads, and basic statistical analyses. The DNA shape annotations were derived with a high-throughput method for DNA shape predictions (DNAshape) and constitute the whole-genome complement to a motif database of transcription factor binding sites (TFBSshape). (Reference: T.P. Chiu et al. 2015. Nucleic Acids Res. 43: D103-109).

red_bullet.gif (914 bytes) PerPlot & PerScan (Computational Microbiology Laboratory, University of Georgia, U.S.A.) tools for analysis of DNA curvature-related periodicity in genomic nucleotide sequences/ (Reference: Mrázek, J. et al.  2011. Microbial Informatics and Experimentation 1:13)

MELTING TEMPERATURE

Knowing the melting temperature of a fragment of DNA or of an oligonucleotide is invaluable in the determining optimal conditions for carrying out hybridizations.  All of the PCR design sites will provide information on oligonucleotides the following will accommodate longer sequences:

red_bullet.gif (914 bytes) uMELT - is a flexible web-based tool for predicting DNA melting curves and denaturation profiles of PCR products. The user defines an amplicon sequence and chooses a set of thermodynamic and experimental parameters that include nearest neighbor stacking energies, loop entropy effects, cation (monovalent and Mg++) concentrations and a temperature range. Using an accelerated partition function algorithm along with chosen parameter values, uMelt interactively calculates and visualizes the mean helicity and the dissociation probability at each sequence position at temperatures within the temperature range. (Reference: Z. Dwight et al. Bioinformatics, 27 (7): 1019–1020)

red_bullet.gif (914 bytes) DAN (Le Centre de Bioinformatique de Bordeaux, France ) - provides one with a plot (in postscript).   For a complete picture of your sequence change "window size" to the size of your fragment, change "shift increment" to zero, and click on "Produce a plot".

red_bullet.gif (914 bytes) Hybridization of two different strands of DNA or RNA - Computations consider 5 different ensembles of structures. Partition function calculations are performed for the heterodimer, the two possible homodimers, and for folding of both single strand. Ensemble free energies are computed, leading to simulation of heat capacity, Cp, as a function of temperature. Base pair probabilities are computed and combined with published extinction coefficients to simulate UV absorbance as a function of temperature. (Reference: N.R. Markham & M. Zuker 2005.  Nucl. Acids Res. 33: W577-W581).

red_bullet.gif (914 bytes) Homodimer simulations - This simulation considers both the folding and dimerization of one single-stranded DNA or RNA molecule. (Reference: N.R. Markham & M. Zuker 2005.  Nucl. Acids Res. 33: W577-W581).